Hints for better results for DNA sequencing:
![]()
NOTE: These helpful hints were designed
to aid scientists in their quest for the perfect sequence. This
is by no means an exhaustive list and we recognize that there
are many other methods and short-cuts out there. The kits and
products listed here are only some of the items available commercially
for DNA sequencing. Simply because we did not mention a kit or
product, does not mean that it will not work. Advances in this
field are being made all the time and we are sure new products
will emerge as time passes. ![]()
1. TEMPLATE:
A. Preparation: The quality of your results is directly proportional to the purity of your template. There are many acceptable methods for purifying DNA for fluorescent sequencing, and you may already have a method you like, but if not, we recommend the following methods. NOTE: ALWAYS RESUSPEND DNA FOR SEQUENCING IN WATER, NOT TE. EDTA WILL INHIBIT THE SEQUENCING REACTION.
single-stranded DNA-QIAprep Spin M13 Kit (Qiagen Inc., Valencia, CA) or PEG precipitation followed by phenol extraction. Be sure to remove all traces of PEG, salt, and phenol! These reagents will inhibit the sequencing reactions.
double-stranded DNA-alkaline lysis/PEG precipitation method, cesium chloride banding, Qiagen Plasmid Kits. Be sure to 1) extract DNA from single bacterial colonies to avoid contamination, and 2) remove ALL traces of salt, PEG, and alcohol as these can inhibit sequencing reactions.
cosmids-alkaline lysis with extra phenol extraction and isopropanol precipitation, cesium chloride banding, Qiagen tip 100/500. We have found that using more starting culture (i.e. 10ml for "miniprep") for DNA extraction works well because the cosmid is usually present in low copy numbers.
PCR-Always check your PCR reactions on a gel to make sure that no other bands are present. These additional bands can cause secondary priming reactions, which results in poor sequencing results. Always purify PCR reactions to remove primers and unincorporated nucleotides, which will interfere with sequencing reactions. For PCR clean up, you can use column purification or ethanol precipitation. However, these two methods will purify ALL DNA present including unwanted PCR products. If additional bands are present in your reactions, you will need to use gel purification to isolate the desired band. This is why it is important to run a small amount of the reaction on a gel to check it.
B. Quantity: Be sure and quantitate the DNA by an acceptable method such as comparing it to a DNA mass ladder on an agarose gel or using a spectrophotometer and measuring the absorbance at 260 nm. We cannot assure good results for unknown amounts of DNA. We recommend the following amounts:
PCR products:
100-200 bp 1-3 ng
200-500 bp 3-10 ng
500-1000 bp 5-20 ng
1000-2000 bp 10-40 ng
>2000 bp 40-100 ngsingle-stranded 50-100 ng
double-stranded 200-500 ng
cosmid, BAC 0.5-1.0 ug
bacterial genomic DNA 2-3 ug
C. Quality: Poor template quality is one of the most common causes of failed sequencing reactions and therefore bad results. Many things can impact template quality and include the following:
Host strain variability/culture conditions-Host
strains such as DH5a, DH10B, C600, and XL1-Blue (There are also
others, but these are the most common.) are well suited for template
purification. Hosts such as HB101 and its derivatives and the
JM100 series, produce large amounts of carbohydrate and nuclease,
therefore they are not as suitable. If you are using a commercial
kit for DNA purification, be sure to check with the manufacturer
for host strains that will produce suitable DNA for sequencing.
DNA should be extracted from freshly grown cultures started from
a single colony grown on fresh media. We don't recommend using
old cultures (>16 hours) for DNA extraction.
Contaminants-Be sure and purify your
DNA sufficiently to avoid the following:
Nucleases: This varies with host strains and method of DNA preparation.
RNA: Use RNase in your preparation methods.
Salt: High salt lowers signal intensity and read length. Precipitate
DNA at room temperature to avoid salt co-precipitation. A room
temperature 70% ethanol wash of the DNA pellet sometimes help
to remove salt.
Ethanol: Be sure to remove all traces of ethanol by drying the
pellet or the ethanol can be evaporated from aqueous DNA preps
with vacuum.
Phenol/
chloroform: Precipitate DNA after phenol/chloroform extraction
to remove the organic solvents.
2. PRIMER CONSIDERATIONS:
A. The primer should have a priming site on the template! I know that sounds obvious, but different cloning vectors have different universal primer sites and it never hurts to double-check. For custom primers, there are a number of computer programs available (some are on the Internet) that will help you to design a good primer.
B. The primer should be about 18-24 bp in length. For A-T rich genomes, the primer may need to be a little longer to raise the melting temperature (Tm) if necessary.
C. The Tm should be above 45oC and approximately 50% GC.
D. It is helpful to have a couple of G or C residues at the 3'-end for stronger binding ("GC clamp").
E. Avoid secondary structure, inverted repeats, primer-dimer formation and runs of identical bases in your primer.
Universal Primers:
- M13 Forward (-20):
- GTAAAACGACGGCCAGTG
- M13 Forward (-41):
- GGTTTTCCCAGTCACGAC
- M13 Reverse (-27):
- GGAAACAGCTATGACCATG
- M13 Reverse (-48):
- AGCGGATAACAATTTCACAC
- SP6
- TACGATTTAGGTGACACTATAG
- T3
- CAATTAACCCTCACTAAAGG
- T7
- GTAATACGACTCACTATAGGG
- pBluescript KS
- TCGAGGTCGACGGTATC
- pBluescript SK
- CGCTCTAGAACTAGTGGATC
![]()
![]()